Review



mls e gfp shren  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc mls e gfp shren
    Mls E Gfp Shren, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mls+e+gfp+shren/MLSE-shREN+(Plasmid+%23105583)/pm38102116-378-18-19
    Average 91 stars, based on 2 article reviews
    mls e gfp shren - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: BRD9 determines the cell fate of hematopoietic stem cells by regulating chromatin state
    Article Snippet: .. For the BRD9-cDNA or shBrd9 transplant model, we utilized MSCV-BRD9-PGK-Puro-IRES-GFP (Addgene, 75114), MSCV-BRD9_dBD-PGK-Puro-IRES-GFP (Addgene, 75115), MSCV-BRD9_N216A-PGK-Puro-IRES-GFP (Addgene, 75116), MLS-E-GFP-shREN (Addgene, 105583), and two different vectors of MLS-E-GFP-shBrd9 whose antisense guide sequence are TTTATTATCATTGAATACCCAG and TTTTATTATCATTGAATACCCA. .. Primary human CD34-enriched cord blood using CD34 MicroBead Kit (Miltenyi Biotec, 130-046-702) was transduced with lentivirus (SGEP shControl and shBRD9, Addgene, 111170) overnight in StemSpanTM SFEM II (StemCell Technologies, 9605) with StemSpanTM CD34 + Expansion Supplement (StemCell Technologies, 2691) and sorted for GFP expression using a FACSAria III (Becton Dickinson).

    Article Title: BRD9 determines the cell fate of hematopoietic stem cells by regulating chromatin state.
    Article Snippet: .. For the BRD9-cDNA or shBrd9 transplant model, we utilized MSCV-BRD9-PGK-Puro-IRES-GFP (Addgene, 75114), MSCVBRD9_dBD-PGK-Puro-IRES-GFP (Addgene, 75115), MSCV-BRD9_N216APGK-Puro-IRES-GFP (Addgene, 75116), MLS-E-GFP-shREN (Addgene, 105583), and two different vectors of MLS-E-GFP-shBrd9 whose antisense guide sequence are TTTATTATCATTGAATACCCAG and TTTTATTATCATTGAATACCCA. .. Cord blood HSC differentiation assays Primary human CD34-enriched cord blood using CD34 MicroBead Kit (Miltenyi Biotec, 130-046-702) was transduced with lentivirus (SGEP shControl and shBRD9, Addgene, 111170) overnight in StemSpanTM SFEM II (StemCell Technologies, 9605) with StemSpanTM CD34+ Expansion Supplement (StemCell Technologies, 2691) and sorted for GFP expression using a FACSAria III (Becton Dickinson).



    Similar Products

    mls e gfp shren  (Addgene inc)
    91
    Addgene inc mls e gfp shren
    Mls E Gfp Shren, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mls+e+gfp+shren/MLSE-shREN+(Plasmid+%23105583)/pm38102116-378-18-19
    Average 91 stars, based on 1 article reviews
    mls e gfp shren - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier

    Image Search Results